UNC1999

Catalog No.S7165

UNC1999 Chemical Structure

Molecular Weight(MW): 569.74

UNC1999 is a potent, orally bioavailable and selective inhibitor of EZH2 and EZH1 with IC50 of 2 nM and 45 nM in cell-free assays, respectively, showing >1000-fold selectivity over a broad range of epigenetic and non-epigenetic targets.

Size Price Stock Quantity  
USD 97 In stock
Bulk Discount

Free Overnight Delivery on orders over $ 500
Next day delivery by 10:00 a.m. Order now.

2 Customer Reviews

  • Ex vivo growth of the SCLC PDX LX92 is significantly inhibited by the EZH2 inhibitors EPZ-5687, GSK343 and UNC1999 as measured by resazurin conversion (two-way analysis of variance, adjusted for multiple comparisons by the method of Dunnet).

    Oncogene, 2015, 10.1038/onc.2015.38. UNC1999 purchased from Selleck.

    A. Treatment with UNC1999 (4-6 μM) reduces viable cell numbers in BT73 as assessed by trypan blue exclusion (n=3; ** P<0.01). B. Treatment with varying concentrations of UNC1999 impairs self renewal in BT73 and BT147 as assessed by sphere assay (n=3).

    Oncotarget, 2016, 7(37):59360-59376. UNC1999 purchased from Selleck.

Purity & Quality Control

Choose Selective Histone Methyltransferase Inhibitors

Biological Activity

Description UNC1999 is a potent, orally bioavailable and selective inhibitor of EZH2 and EZH1 with IC50 of 2 nM and 45 nM in cell-free assays, respectively, showing >1000-fold selectivity over a broad range of epigenetic and non-epigenetic targets.
Features The first orally bioavailable inhibitor against wild-type and mutant EZH2 as well as EZH1.
Targets
EZH2 [2]
(Cell-free assay)
EZH1 [2]
(Cell-free assay)
2 nM 45 nM
In vitro

UNC1999 is highly potent for both EZH2 Y641N and EZH2 Y641F mutants in vitro. UNC1999 causes concentration-dependent reductions of H3K27me3 in MCF10A cells with IC50 of 124 nM , while shows low cellular toxicity. UNC1999 displays potent, concentration-dependent inhibition of cell proliferation with EC50 of 633 nM in a DLBCL cell line harboring the EZH2Y641N mutant. In addition, biotinylated UNC1999 enriches EZH2 from HEK293T cell lysates, and thus may be used in chemoproteomics studies. [1]

Cell Data
Cell Lines Assay Type Concentration Incubation Time Formulation Activity Description PMID
human MCF10A cells MmfUSpVv[3Srb36gZZN{[Xl? NGraXnI4OiCq NHLj[45KdmirYnn0bY9vKG:oIFXaTFIhcW5iaIXtZY4hVUOIMUDBJINmdGy|IHHzd4V{e2WmIHHzJJJm\HWldHnvckBw\iCKM1uyO41mOyCuZY\lcEBi\nSncjC3NkBpenNiYomgW4V{fGW{bjDicI91KGGwYXz5d4l{NCCLQ{WwQVAvOTJ2IN88US=> M3zF[VI2PDB4OEWz
human MCF10A cells NWDac5puS3m2b4TvfIlkyqCjc4PhfS=> NYfXXXR5S3m2b4TvfIlkcXS7IHHnZYlve3RiaIXtZY4hVUOIMUDBJINmdGy|IHHzd4V{e2WmIHHzJINmdGxidnnhZoltcXS7IHL5JGFt[W2jcjDCcJVmKGG|c3H5MEBGSzVyPUG5MlIh|ryP MlHPNlU1ODZ6NUO=

... Click to View More Cell Line Experimental Data

In vivo Treatment of UNC1999 (150 and 50 mg/kg, i.p.) results in the plasma concentrations of UNC1999 above its cellular IC50 over 24 hours in vivo. In addition, UNC1999 is also orally bioavailable in mice, which makes chronic animal studies more practical and convenient. [1]

Protocol

Kinase Assay:

[1]

+ Expand

Scintillation Proximity Assay:

Methyltransferase activity assays are performed by monitoring the incorporation of tritiumlabeled methyl group from S-adenosylmethionine (3H-SAM) to biotinylated peptide substrates using Scintillation Proximity Assay (SPA) for PRC2-EZH2 trimeric complex (EZH2:EED:SUZ12), PRC2-EZH1 pentameric complex (EZH1:EED:SUZ12:RBBP4:AEBP2), SETD7, G9a, GLP, SETDB1, SETD8, SUV420H1, SUV420H2, SUV39H2, MLL1 tetrameric complex (MLL:WDR5:RbBP5:ASH2L), PRMT1, PRMT3, PRMT5-MEP50 complex and SMYD2. The reaction buffer for SMYD2 and SMYD3 is 50 mM Tris pH 9.0, 5 mM DTT, 0.01% TritonX-100; for G9a, GLP and SUV39H2 is 25 mM potassium phosphate pH 8.0, 1 mM EDTA, 2 mM MgCl2 and 0.01% Triton X-100; and for other HMTs 20 mM Tris pH 8.0, 5 mM DTT, 0.01% TritonX-100. To stop the enzymatic reactions, 10 μL of 7.5 M guanidine hydrochloride is added, followed by 180 μL of buffer, mixed and transferred to a 384-well FlashPlate. After mixing, the reaction mixtures are incubated and the CPM counts are measured using Topcount plate reader. The CPM counts in the absence of compound for each data set are defined as 100% activity. In the absence of the enzyme, the CPM counts in each data set are defined as background (0%). IC50 values are determined using compound concentrations ranging from 100 nM to 100 μM. The IC50 values are determined using SigmaPlot software. EZH2-Y641F assays are performed using 30 nM of enzyme in 20 mM Tris pH 8, 5 mM DTT, 0.01% Triton X-100, 5 μM SAM and 1 μM of H3 (1-24) peptide (same as for the wild-type PRC2-EZH2 complex). For DNMT1, the assay is performed using hemimethylated dsDNA as a substrate. The dsDNA substrate is prepared by annealing two complementary strands (biotintlated forward strand: BGAGCCCGTAAGCCCGTTCAGGTCG and reverse strand: CGACCTGAACGGGCTTACGGGCTC), synthesized by Eurofins MWG Operon. Reaction buffer is 20 mM Tris-HCl, pH 8.0, 5mM DTT, 0.01% Triton X-100. Methyltransferase activity assays for DOT1L is performed using Filter-plates. Reaction mixtures in 20 mM Tris-HCl, pH 8.0, 5 mM DTT, 2 mM MgCl2 and 0.01% Triton X-100 are incubated at room temperature for 1h, 100 μL 10% TCA is added, mixed and transferred to filter-plate. Plates are centrifuged at 2000 rpm for 2 min followed by 2 additional 10% TCA wash and one ethanol wash (180 μL) followed by centrifugation. Plates are dried and 100 μL MicroO is added and centrifuged. 70 μL MicroO is added and CPM are measured using Topcount plate reader.
Cell Research:

[1]

+ Expand
  • Cell lines: DLBCL cell line harboring the EZH2Y641N mutant
  • Concentrations: ~5 μM
  • Incubation Time: 8 days
  • Method:

    DB cells, a diffuse-large B-cell lymphoma cell line harboring the EZH2 Y641N mutation, are obtained from ATCC and cultured in RPMI 1640 supplemented with 10% fetal bovine serum, antibiotics, and various concentrations of compounds (DMSO control, UNC1999, or UNC2400). The medium containing the test compound or control is refreshed every 3 days. The numbers of viable cells from at least three independent experiments are measured using TC20 automated cell counter system. Total histones are prepared from cell nuclei using an acidic extraction protocol. About 1 μg of total histones is separated using 15% SDS-PAGE, transferred to PVDF membranes, and probed with histone antibodies. Antibodies used in this study are those against EZH2, general H3, and H3K27me3.


    (Only for Reference)
Animal Research:

[1]

+ Expand
  • Animal Models: Male Swiss albino mice
  • Formulation: DMSO
  • Dosages: ~150 mg/kg (i.p.), ~50 mg/kg (oral)
  • Administration: Intraperitoneal administration or oral administration
    (Only for Reference)

Solubility (25°C)

In vitro DMSO 50 mg/mL (87.75 mM)
Ethanol 50 mg/mL (87.75 mM)
Water Insoluble

* Please note that Selleck tests the solubility of all compounds in-house, and the actual solubility may differ slightly from published values. This is normal and is due to slight batch-to-batch variations.

Chemical Information

Molecular Weight 569.74
Formula

C33H43N7O2

CAS No. 1431612-23-5
Storage powder
Synonyms N/A

Bio Calculators

Molarity Calculator

Molarity Calculator

Calculate the mass, volume or concentration required for a solution. The Selleck molarity calculator is based on the following equation:

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

  • Mass
    Concentration
    Volume
    Molecular Weight

*When preparing stock solutions, please always use the batch-specific molecular weight of the product found on the via label and MSDS / COA (available on product pages).

Dilution Calculator

Dilution Calculator

Calculate the dilution required to prepare a stock solution. The Selleck dilution calculator is based on the following equation:

Concentration (start) x Volume (start) = Concentration (final) x Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2 ( Input Output )

  • C1
    V1
    C2
    V2

* When preparing stock solutions always use the batch-specific molecular weight of the product found on the vial label and MSDS / COA (available online).

The Serial Dilution Calculator Equation

  • Serial Dilutions

  • Computed Result

  • C1=C0/X C1: LOG(C1):
    C2=C1/X C2: LOG(C2):
    C3=C2/X C3: LOG(C3):
    C4=C3/X C4: LOG(C4):
    C5=C4/X C5: LOG(C5):
    C6=C5/X C6: LOG(C6):
    C7=C6/X C7: LOG(C7):
    C8=C7/X C8: LOG(C8):
Molecular Weight Calculator

Molecular Weight Calculator

Enter the chemical formula of a compound to calculate its molar mass and elemental composition:

Total Molecular Weight: g/mol

Tip: Chemical formula is case sensitive. C10H16N2O2 c10h16n2o2

Instructions to calculate molar mass (molecular weight) of a chemical compound:

To calculate molar mass of a chemical compound, please enter its chemical formula and click 'Calculate'.

Definitions of molecular mass, molecular weight, molar mass and molar weight:

Molecular mass (molecular weight) is the mass of one molecule of a substance and is expressed in the unified atomic mass units (u). (1 u is equal to 1/12 the mass of one atom of carbon-12)
Molar mass (molar weight) is the mass of one mole of a substance and is expressed in g/mol.

Molarity Calculator

Mass Concentration Volume Molecular Weight

Tech Support

Answers to questions you may have can be found in the inhibitor handling instructions. Topics include how to prepare stock solutions, how to store inhibitors, and issues that need special attention for cell-based assays and animal experiments.

Handling Instructions

Tel: +1-832-582-8158 Ext:3

If you have any other enquiries, please leave a message.

  • * Indicates a Required Field

Related Antibodies

Histone Methyltransferase Signaling Pathway Map

Tags: buy UNC1999 | UNC1999 supplier | purchase UNC1999 | UNC1999 cost | UNC1999 manufacturer | order UNC1999 | UNC1999 distributor
×
Cell Lines Assay Type Concentration Incubation Time Formulation Activity Description PMID